-
PurposeRetroviral vector for the expression of constitutive Stat5a (puromycin resistance)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBABE
- Backbone size w/o insert (bp) 5170
- Total vector size (bp) 7655
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStat5a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2382
-
Mutationchanged Histidine 298 to Arginine and Serine 710 to Phenylalanine
-
GenBank IDNM_011488
-
Entrez GeneStat5a (a.k.a. STAT5)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcGttcgac
- 3′ sequencing primer ggactttccacacctggttgct (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysubcloned from pMXSTAT5A1*6: Onishi, M., Nosaka, T., Misawa, K., Mui, A. L., Gorman, D., McMahon, M., Miyajima, A., and Kitamura, T. (1998) Mol Cell Biol 18, 3871-3879
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE-Stat5a1*6 was a gift from Gerardo Ferbeyre (Addgene plasmid # 130668 ; http://n2t.net/addgene:130668 ; RRID:Addgene_130668) -
For your References section:
Myc down-regulation as a mechanism to activate the Rb pathway in STAT5A-induced senescence. Mallette FA, Gaumont-Leclerc MF, Huot G, Ferbeyre G. J Biol Chem. 2007 Nov 30;282(48):34938-44. doi: 10.1074/jbc.M707074200. Epub 2007 Oct 3. 10.1074/jbc.M707074200 PubMed 17913706