Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBABE-Stat5a1*6
(Plasmid #130668)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE
  • Backbone size w/o insert (bp) 5170
  • Total vector size (bp) 7655
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Stat5a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2382
  • Mutation
    changed Histidine 298 to Arginine and Serine 710 to Phenylalanine
  • GenBank ID
    NM_011488
  • Entrez Gene
    Stat5a (a.k.a. STAT5)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcGttcgac
  • 3′ sequencing primer ggactttccacacctggttgct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    subcloned from pMXSTAT5A1*6: Onishi, M., Nosaka, T., Misawa, K., Mui, A. L., Gorman, D., McMahon, M., Miyajima, A., and Kitamura, T. (1998) Mol Cell Biol 18, 3871-3879
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABE-Stat5a1*6 was a gift from Gerardo Ferbeyre (Addgene plasmid # 130668 ; http://n2t.net/addgene:130668 ; RRID:Addgene_130668)
  • For your References section:

    Myc down-regulation as a mechanism to activate the Rb pathway in STAT5A-induced senescence. Mallette FA, Gaumont-Leclerc MF, Huot G, Ferbeyre G. J Biol Chem. 2007 Nov 30;282(48):34938-44. doi: 10.1074/jbc.M707074200. Epub 2007 Oct 3. 10.1074/jbc.M707074200 PubMed 17913706