RFP-(SUMO FAAA)3
(Plasmid
#130703)
-
PurposeMammalian expression plasmid for negative control of mCherry-(SUMO)3.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepC1-mCherry
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5721
-
Modifications to backboneunknown
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3 copies of human SUMO1 separated by (GGS)4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)999
-
MutationFKVK sequence in each SUMO1 module changed to FAAA
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspE1 (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- 3′ sequencing primer TGTGGGAGGTTTTTTAAAGCAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RFP-(SUMO FAAA)3 was a gift from Michael Rosen (Addgene plasmid # 130703 ; http://n2t.net/addgene:130703 ; RRID:Addgene_130703) -
For your References section:
Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333