pAG104 FAST
(Plasmid #130720)

• Purpose: Expresses FAST (also called YFAST) in mammalian cells
• Depositing Lab: Arnaud Gautier
• Publication: Plamont et al Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):497-502. doi: 10.1073/pnas.1513094113. Epub 2015 Dec 28.

Backbone

• Vector backbone: pIRES
• Backbone size w/o insert (bp): 4005
• Total vector size (bp): 4380
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FAST
• Alt name: YFAST, FAST1
• Alt name: Fluorescence-activating and absorption-shifting tag
• Species: Synthetic
• Insert Size (bp): 375
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry