-
PurposeExpresses FAST (also called YFAST) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4005
- Total vector size (bp) 4380
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFAST
-
Alt nameYFAST, FAST1
-
Alt nameFluorescence-activating and absorption-shifting tag
-
SpeciesSynthetic
-
Insert Size (bp)375
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG104 FAST was a gift from Arnaud Gautier (Addgene plasmid # 130720 ; http://n2t.net/addgene:130720 ; RRID:Addgene_130720) -
For your References section:
Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo. Plamont MA, Billon-Denis E, Maurin S, Gauron C, Pimenta FM, Specht CG, Shi J, Querard J, Pan B, Rossignol J, Moncoq K, Morellet N, Volovitch M, Lescop E, Chen Y, Triller A, Vriz S, Le Saux T, Jullien L, Gautier A. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):497-502. doi: 10.1073/pnas.1513094113. Epub 2015 Dec 28. 10.1073/pnas.1513094113 PubMed 26711992