pAG247 His-iFAST
(Plasmid
#130808)
-
PurposeExpresses His-tagged iFAST in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 5704
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiFAST
-
Alt nameimproved FAST
-
Alt nameimproved fluorescence-activating and absorption-shifting tag
-
Alt nameFAST2
-
SpeciesSynthetic
-
Insert Size (bp)375
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG247 His-iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130808 ; http://n2t.net/addgene:130808 ; RRID:Addgene_130808) -
For your References section:
Improved Chemical-Genetic Fluorescent Markers for Live Cell Microscopy. Tebo AG, Pimenta FM, Zhang Y, Gautier A. Biochemistry. 2018 Oct 2;57(39):5648-5653. doi: 10.1021/acs.biochem.8b00649. Epub 2018 Sep 17. 10.1021/acs.biochem.8b00649 PubMed 30204425