Skip to main content

pCAG-ETF1-E55D
(Plasmid #130876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Unknown
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 6150
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Eukaryotic transcritional termination factor ETF1-E55D
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1320
  • Mutation
    E55D
  • Entrez Gene
    ETF1 (a.k.a. D5S1995, ERF, ERF1, RF1, SUP45L1, TB3-1)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer TTCCTACAGCTCCTGGGCAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-ETF1-E55D was a gift from Prashant Mali (Addgene plasmid # 130876 ; http://n2t.net/addgene:130876 ; RRID:Addgene_130876)
  • For your References section:

    Oligonucleotide conjugated multi-functional adeno-associated viruses. Katrekar D, Moreno AM, Chen G, Worlikar A, Mali P. Sci Rep. 2018 Feb 26;8(1):3589. doi: 10.1038/s41598-018-21742-x. 10.1038/s41598-018-21742-x PubMed 29483550