-
PurposeEncodes ETF1 with an E55D substitution
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 6150
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEukaryotic transcritional termination factor ETF1-E55D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1320
-
MutationE55D
-
Entrez GeneETF1 (a.k.a. D5S1995, ERF, ERF1, RF1, SUP45L1, TB3-1)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer TTCCTACAGCTCCTGGGCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-ETF1-E55D was a gift from Prashant Mali (Addgene plasmid # 130876 ; http://n2t.net/addgene:130876 ; RRID:Addgene_130876) -
For your References section:
Oligonucleotide conjugated multi-functional adeno-associated viruses. Katrekar D, Moreno AM, Chen G, Worlikar A, Mali P. Sci Rep. 2018 Feb 26;8(1):3589. doi: 10.1038/s41598-018-21742-x. 10.1038/s41598-018-21742-x PubMed 29483550