-
PurposeExpression of CD81-pHluorin for visualization of multivesicular body-plasma membrane fusion.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-Sport6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4360
- Total vector size (bp) 5827
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD81-pHluorin
-
SpeciesH. sapiens (human); aequorea victoria
-
Insert Size (bp)1467
-
MutationpHluorin inserted between Leu-49 and Gly-50 in extracellular loop
-
Entrez GeneCD81 (a.k.a. CVID6, S5.7, TAPA1, TSPAN28)
- Promoter CMV
-
Tag
/ Fusion Protein
- pHluorin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site xbaI (not destroyed)
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
- 3′ sequencing primer AATACGACTCACTATAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Sport6-CD81-pHluorin was a gift from DM Pegtel (Addgene plasmid # 130903 ; http://n2t.net/addgene:130903 ; RRID:Addgene_130903) -
For your References section:
Quantifying exosome secretion from single cells reveals a modulatory role for GPCR signaling. Verweij FJ, Bebelman MP, Jimenez CR, Garcia-Vallejo JJ, Janssen H, Neefjes J, Knol JC, de Goeij-de Haas R, Piersma SR, Baglio SR, Verhage M, Middeldorp JM, Zomer A, van Rheenen J, Coppolino MG, Hurbain I, Raposo G, Smit MJ, Toonen RFG, van Niel G, Pegtel DM. J Cell Biol. 2018 Mar 5;217(3):1129-1142. doi: 10.1083/jcb.201703206. Epub 2018 Jan 16. 10.1083/jcb.201703206 PubMed 29339438