pB-TAG-HES7
(Plasmid
#130935)
-
PurposePiggyBac vector for DOX-inducible human HES7-IRES-EGFP expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepB-TAG-ERP2
-
Backbone manufactureraddgene 80479
- Total vector size (bp) 11406
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHES7
-
Alt nameHES7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)693
-
Entrez GeneHES7 (a.k.a. SCDO4, bHLHb37, hHes7)
- Promoter TetO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer acgtctagaacgtctccctatc
- 3′ sequencing primer GTCGTCCTTGAAGAAGATGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-TAG-HES7 was a gift from James Thomson (Addgene plasmid # 130935 ; http://n2t.net/addgene:130935 ; RRID:Addgene_130935) -
For your References section:
An In Vitro Human Segmentation Clock Model Derived from Embryonic Stem Cells. Chu LF, Mamott D, Ni Z, Bacher R, Liu C, Swanson S, Kendziorski C, Stewart R, Thomson JA. Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090. 10.1016/j.celrep.2019.07.090 PubMed 31461642