pLY151
(Plasmid
#130947)
-
PurposepspFΔHTH::λN22plus gene controlled by promoter PrhaB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA221
-
Backbone manufacturerby de Lorenzo's Lab (The Standard European Vector Architecture (SEVA) platform)
- Backbone size w/o insert (bp) 3821
- Total vector size (bp) 6073
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namerhaS
-
SpeciesE. coli
-
Insert Size (bp)993
- Promoter Pcon
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCGGATAACAATTTCACACAGGAG
- 3′ sequencing primer CACGAATATTTCCCGGCCAACGATAATTCAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepspFΔHTH::λN22plus
-
SpeciesSynthetic
-
Insert Size (bp)1259
-
MutationThe HTH domain of the pspF gene was deleted (297-326); Mutations D2N and Q4R in the λN22 domain.
- Promoter PrhaB
-
Tag
/ Fusion Protein
- pspFΔHTH::λN22plus (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ACGCTGTGGTTAACGCGCCAGTGAG
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Top10 bacterial strain should be used for downstream applications
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLY151 was a gift from Baojun Wang (Addgene plasmid # 130947 ; http://n2t.net/addgene:130947 ; RRID:Addgene_130947) -
For your References section:
Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Liu Y, Wan X, Wang B. Nat Commun. 2019 Aug 26;10(1):3693. doi: 10.1038/s41467-019-11479-0. 10.1038/s41467-019-11479-0 PubMed 31451697