Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLY151
(Plasmid #130947)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130947 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSEVA221
  • Backbone manufacturer
    by de Lorenzo's Lab (The Standard European Vector Architecture (SEVA) platform)
  • Backbone size w/o insert (bp) 3821
  • Total vector size (bp) 6073
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Culture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    rhaS
  • Species
    E. coli
  • Insert Size (bp)
    993
  • Promoter Pcon

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGGAG
  • 3′ sequencing primer CACGAATATTTCCCGGCCAACGATAATTCAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pspFΔHTH::λN22plus
  • Species
    Synthetic
  • Insert Size (bp)
    1259
  • Mutation
    The HTH domain of the pspF gene was deleted (297-326); Mutations D2N and Q4R in the λN22 domain.
  • Promoter PrhaB
  • Tag / Fusion Protein
    • pspFΔHTH::λN22plus (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ACGCTGTGGTTAACGCGCCAGTGAG
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Top10 bacterial strain should be used for downstream applications

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLY151 was a gift from Baojun Wang (Addgene plasmid # 130947 ; http://n2t.net/addgene:130947 ; RRID:Addgene_130947)
  • For your References section:

    Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Liu Y, Wan X, Wang B. Nat Commun. 2019 Aug 26;10(1):3693. doi: 10.1038/s41467-019-11479-0. 10.1038/s41467-019-11479-0 PubMed 31451697