Skip to main content

PX458-3xHA-SpCas9
(Plasmid #130968)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130968 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Total vector size (bp) 9310
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3xHA-NLS-SpCas9
  • Alt name
    3xHA-NLS-SpCas9-T2A-EGFP
  • Species
    Synthetic; Francisella tularensis subsp. novicida
  • Insert Size (bp)
    406
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3x HA (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on backbone)
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CBA Forward (5' CTCCGGGCTGTAATTAGCTG 3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-3xHA-SpCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 130968 ; http://n2t.net/addgene:130968 ; RRID:Addgene_130968)
  • For your References section:

    Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Acharya S, Mishra A, Paul D, Ansari AH, Azhar M, Kumar M, Rauthan R, Sharma N, Aich M, Sinha D, Sharma S, Jain S, Ray A, Jain S, Ramalingam S, Maiti S, Chakraborty D. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 10.1073/pnas.1818461116 PubMed 31570623