pRS0045
(Plasmid
#131124)
-
PurposeMammalian Target-ACE expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 6480
- Total vector size (bp) 9856
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTadA-linker(32aa)-TadA*(7.10)-linker(32aa)-nCas9-PmCDA1-UGI
-
Alt nameTarget-ACE
-
SpeciesSynthetic
-
Insert Size (bp)6480
-
MutationA262T, R324L, S409I, E480K, E543D, M694I, E1219V in TadA, D10A in SpCas9
- Promoter CMV promoter
-
Tags
/ Fusion Proteins
- TadA (N terminal on insert)
- PmCDA1 (C terminal on insert)
- UGI (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CTGGCAACTAGAAGGCACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/102919/
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/729269v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS0045 was a gift from Nozomu Yachie (Addgene plasmid # 131124 ; http://n2t.net/addgene:131124 ; RRID:Addgene_131124) -
For your References section:
Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365