pTIGER_mNeonGreen::3xFLAG::dCrk
(Plasmid
#131137)
-
PurposeUASp construct for over-expression of Drosophila Crk with N-terminal monomeric NeonGreen and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTIGER
- Backbone size w/o insert (bp) 10240
- Total vector size (bp) 11733
-
Vector typeInsect Expression
-
Selectable markersmini-White
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCrk
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1597
-
Entrez GeneCrk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
-
Tags
/ Fusion Proteins
- mNeonGreen (N terminal on insert)
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site Sph1 (unknown if destroyed)
- 5′ sequencing primer TTTGAAAACCGGTGATAGAGC
- 3′ sequencing primer AACTGAGTTTCTTCGAAATTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTIGER_mNeonGreen::3xFLAG::dCrk was a gift from Mark Peifer (Addgene plasmid # 131137 ; http://n2t.net/addgene:131137 ; RRID:Addgene_131137) -
For your References section:
The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events. Spracklen AJ, Thornton-Kolbe EM, Bonner AN, Florea A, Compton PJ, Fernandez-Gonzalez R, Peifer M. Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302. 10.1091/mbc.E19-05-0302 PubMed 31318326