pU6-chiRNA_dCrkgRNA1
(Plasmid
#131139)
-
PurposeEncodes gRNA targeting Drosophila crk locus. Cuts 110bp upstream of the transcription start site. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-BbsI-chiRNA
- Backbone size w/o insert (bp) 3458
- Total vector size (bp) 3459
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCrk gRNA1
-
gRNA/shRNA sequenceGCTGACAGTACGTCCTAAA
-
SpeciesD. melanogaster (fly)
-
Entrez GeneCrk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AGTCAATAAATCGAACTGTGTTTTCA
- 3′ sequencing primer CCATGATTACGCCAAGCTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-chiRNA_dCrkgRNA1 was a gift from Mark Peifer (Addgene plasmid # 131139 ; http://n2t.net/addgene:131139 ; RRID:Addgene_131139) -
For your References section:
The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events. Spracklen AJ, Thornton-Kolbe EM, Bonner AN, Florea A, Compton PJ, Fernandez-Gonzalez R, Peifer M. Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302. 10.1091/mbc.E19-05-0302 PubMed 31318326