Skip to main content

Opto-casp9_VfAU1-LOV_casp9
(Plasmid #131220)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131220 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1-
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5318
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto-casp9 (VfAU1-LOV_casp9)
  • Species
    H. sapiens (human); V. frigida
  • Insert Size (bp)
    1338
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Opto-casp9_VfAU1-LOV_casp9 was a gift from Harald Janovjak (Addgene plasmid # 131220 ; http://n2t.net/addgene:131220 ; RRID:Addgene_131220)
  • For your References section:

    Engineering Strategy and Vector Library for the Rapid Generation of Modular Light-Controlled Protein-Protein Interactions. Tichy AM, Gerrard EJ, Legrand JMD, Hobbs RM, Janovjak H. J Mol Biol. 2019 May 29. pii: S0022-2836(19)30317-1. doi: 10.1016/j.jmb.2019.05.033. 10.1016/j.jmb.2019.05.033 PubMed 31150735