Skip to main content

Opto-casp9_casp9-VfAU1-LOV
(Plasmid #131222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131222 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 131222-D50 50 μg of DNA in Tris buffer $495
DNA 131222-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1-
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5318
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto-casp9 (casp9-VfAU1-LOV)
  • Species
    H. sapiens (human); V. frigida
  • Insert Size (bp)
    1338
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Opto-casp9_casp9-VfAU1-LOV was a gift from Harald Janovjak (Addgene plasmid # 131222 ; http://n2t.net/addgene:131222 ; RRID:Addgene_131222)
  • For your References section:

    Engineering Strategy and Vector Library for the Rapid Generation of Modular Light-Controlled Protein-Protein Interactions. Tichy AM, Gerrard EJ, Legrand JMD, Hobbs RM, Janovjak H. J Mol Biol. 2019 May 29. pii: S0022-2836(19)30317-1. doi: 10.1016/j.jmb.2019.05.033. 10.1016/j.jmb.2019.05.033 PubMed 31150735