nCas9-UGI control for Target-AID (pRZ1047)
(Plasmid
#131299)
-
PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP (Target-AID without pmCDA1).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCAG
-
Backbone manufacturerpSQT817 (Addgene #53373)
- Backbone size w/o insert (bp) 4843
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP
-
SpeciesStreptococcus pyogenes, Bacillus subtilis bacteriophage PBS1, SV40, porcine teschovirus-1, Aequorea victoria, in parts synthetic
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTGCTAACCATGTTCATGCC
- 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bybased on Addgene #79620
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nCas9-UGI control for Target-AID (pRZ1047) was a gift from Keith Joung (Addgene plasmid # 131299 ; http://n2t.net/addgene:131299 ; RRID:Addgene_131299) -
For your References section:
CRISPR DNA base editors with reduced RNA off-target and self-editing activities. Grunewald J, Zhou R, Iyer S, Lareau CA, Garcia SP, Aryee MJ, Joung JK. Nat Biotechnol. 2019 Sep 2. pii: 10.1038/s41587-019-0236-6. doi: 10.1038/s41587-019-0236-6. 10.1038/s41587-019-0236-6 PubMed 31477922