-
PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
- Backbone size w/o insert (bp) 3399
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
-
SpeciesE.coli, Streptococcus pyogenes
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybased on Addgene #112095
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SECURE miniABEmax-V82G (pJUL1828) was a gift from Keith Joung (Addgene plasmid # 131313 ; http://n2t.net/addgene:131313 ; RRID:Addgene_131313) -
For your References section:
CRISPR DNA base editors with reduced RNA off-target and self-editing activities. Grunewald J, Zhou R, Iyer S, Lareau CA, Garcia SP, Aryee MJ, Joung JK. Nat Biotechnol. 2019 Sep 2. pii: 10.1038/s41587-019-0236-6. doi: 10.1038/s41587-019-0236-6. 10.1038/s41587-019-0236-6 PubMed 31477922