pTSN7A
(Plasmid
#131319)
-
PurposeExpressing synthetic TetR-GFP protein in N. crassa (from the his-3 locus)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131319 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMF272
- Backbone size w/o insert (bp) 6805
- Total vector size (bp) 8576
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR-GFP
-
SpeciesSynthetic
-
Insert Size (bp)1771
- Promoter TrpC (from pCSN44)
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTAGATGATGGTTAGGCA
- 3′ sequencing primer CGCCCTAATTAACCCTCACTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEGFP is from pMF272; TetR is synthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSN7A was a gift from Eugene Gladyshev (Addgene plasmid # 131319 ; http://n2t.net/addgene:131319 ; RRID:Addgene_131319) -
For your References section:
Developing a tetO/TetR system in Neurospora crassa. Nguyen TS, Gladyshev E. Fungal Genet Biol. 2020 Mar;136:103316. doi: 10.1016/j.fgb.2019.103316. Epub 2019 Dec 9. 10.1016/j.fgb.2019.103316 PubMed 31821884