Skip to main content

pTSN7B
(Plasmid #131320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131320 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 131320-D50 50 μg of DNA in Tris buffer $495
DNA 131320-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCSR1
  • Backbone size w/o insert (bp) 5884
  • Total vector size (bp) 7761
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TetR-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    1877
  • Promoter TrpC (from pCSN44)
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site StuI (destroyed during cloning)
  • 5′ sequencing primer CGCAATGTCGTCAATGGCTG
  • 3′ sequencing primer AGCGACAGTGATGACGATGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Entire insert is subcloned from pTSN7A

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSN7B was a gift from Eugene Gladyshev (Addgene plasmid # 131320 ; http://n2t.net/addgene:131320 ; RRID:Addgene_131320)
  • For your References section:

    Developing a tetO/TetR system in Neurospora crassa. Nguyen TS, Gladyshev E. Fungal Genet Biol. 2020 Mar;136:103316. doi: 10.1016/j.fgb.2019.103316. Epub 2019 Dec 9. 10.1016/j.fgb.2019.103316 PubMed 31821884
Commonly requested with: