pTSN7B
(Plasmid
#131320)
-
PurposeExpressing synthetic TetR-GFP protein in N. crassa (from the csr-1 locus)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCSR1
- Backbone size w/o insert (bp) 5884
- Total vector size (bp) 7761
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR-GFP
-
SpeciesSynthetic
-
Insert Size (bp)1877
- Promoter TrpC (from pCSN44)
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site StuI (destroyed during cloning)
- 5′ sequencing primer CGCAATGTCGTCAATGGCTG
- 3′ sequencing primer AGCGACAGTGATGACGATGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEntire insert is subcloned from pTSN7A
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSN7B was a gift from Eugene Gladyshev (Addgene plasmid # 131320 ; http://n2t.net/addgene:131320 ; RRID:Addgene_131320) -
For your References section:
Developing a tetO/TetR system in Neurospora crassa. Nguyen TS, Gladyshev E. Fungal Genet Biol. 2020 Mar;136:103316. doi: 10.1016/j.fgb.2019.103316. Epub 2019 Dec 9. 10.1016/j.fgb.2019.103316 PubMed 31821884