Skip to main content

pORANGE GFP-Grin2a KI
(Plasmid #131433)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131433 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pORANGE
  • Backbone size w/o insert (bp) 9322
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and GFP donor
  • gRNA/shRNA sequence
    GCGATCCGGCGCAGAACGCGG
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Grin2a (a.k.a. GluN2A, NMDAR2A, NR2A)
  • Promoter U6 and Cbh
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer aaggctgttagagagataattggaa
  • 3′ sequencing primer cgggccatttaccgtaagtt
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/700187v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORANGE GFP-Grin2a KI was a gift from Harold MacGillavry (Addgene plasmid # 131433)
  • For your References section:

    ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons. Willems J, de Jong APH, Scheefhals N, Mertens E, Catsburg LAE, Poorthuis RB, de Winter F, Verhaagen J, Meye FJ, MacGillavry HD. PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665. 10.1371/journal.pbio.3000665 PubMed 32275651