MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
(Plasmid
#131463)
-
PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A G34R, PDGFRA D842V, and TRP53
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMADR pDonor
-
Backbone manufacturerBreunig Lab
- Total vector size (bp) 10927
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology ; Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH3F3A-G34R-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
MutationH3F3A G34R, Pdgfra D842V
- Promoter none (4x polyA to mitigate episomal expression)
-
Tag
/ Fusion Protein
- Trp53-V5, H3F3A-EGFP-AU1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
- 3′ sequencing primer WPRE-R (addgene)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE was a gift from Joshua Breunig (Addgene plasmid # 131463 ; http://n2t.net/addgene:131463 ; RRID:Addgene_131463) -
For your References section:
Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496