pORANGE GFP-Clta KI
(Plasmid
#131483)
-
PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131483 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepORANGE
- Backbone size w/o insert (bp) 9258
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA and GFP donor
-
gRNA/shRNA sequenceGGATCCAACTCAGCCATGA
-
SpeciesR. norvegicus (rat)
-
Entrez GeneClta (a.k.a. LCA1, LCA2, LCA3)
- Promoter U6 and Cbh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer aaggctgttagagagataattggaa
- 3′ sequencing primer cgggccatttaccgtaagtt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORANGE GFP-Clta KI was a gift from Harold MacGillavry (Addgene plasmid # 131483 ; http://n2t.net/addgene:131483 ; RRID:Addgene_131483) -
For your References section:
ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons. Willems J, de Jong APH, Scheefhals N, Mertens E, Catsburg LAE, Poorthuis RB, de Winter F, Verhaagen J, Meye FJ, MacGillavry HD. PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665. 10.1371/journal.pbio.3000665 PubMed 32275651