Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #131609)


Item Catalog # Description Quantity Price (USD)
Plasmid 131609 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 5900
  • Vector type
    Bacterial Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Runx1 (a.k.a. AM, AML1, CBF-alpha-2, Cbfa, Cbfa2, Pebp, Pebp2a2, Pebpa2b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HPA (unknown if destroyed)
  • 5′ sequencing primer gacggcatcgcagcttggat
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-Runx1 was a gift from Kateri Moore & Filipe Pereira (Addgene plasmid # 131609 ; ; RRID:Addgene_131609)
  • For your References section:

    Induction of a hemogenic program in mouse fibroblasts. Pereira CF, Chang B, Qiu J, Niu X, Papatsenko D, Hendry CE, Clark NR, Nomura-Kitabayashi A, Kovacic JC, Ma'ayan A, Schaniel C, Lemischka IR, Moore K. Cell Stem Cell. 2013 Aug 1;13(2):205-18. doi: 10.1016/j.stem.2013.05.024. Epub 2013 Jun 13. 10.1016/j.stem.2013.05.024 PubMed 23770078