pGL4.23-SCP1-ccdB
(Plasmid
#131628)
-
Purpose(Empty Backbone) Modified STARR-seq plasmid to measure enhancer activity (SCP1 promoter; ccdb gene at cloning site)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.23
-
Backbone manufacturerPromega
- Backbone size (bp) 5813
-
Modifications to backboneMinimal promoter was replaced with a synthesized Super core promoter 1 (SCP1). The CmR-ccdB suicide gene was PCR amplified from the STARR-seq vector (kindly provided by Dr. Alexander Stark) using primers containing the SphI-HF and the NdeI recognition site. It was then assembled with the linearized pGL4.23-SCP1 vector (digested by FseI) using Gibson assembly
-
Vector typeMammalian Expression, Bacterial Expression, Luciferase
- Promoter SCP1
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGCTGGAACACGGTAAA
- 3′ sequencing primer CGACGGATCCTTATCGATTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23-SCP1-ccdB was a gift from Kevin White (Addgene plasmid # 131628 ; http://n2t.net/addgene:131628 ; RRID:Addgene_131628) -
For your References section:
Functional assessment of human enhancer activities using whole-genome STARR-sequencing. Liu Y, Yu S, Dhiman VK, Brunetti T, Eckart H, White KP. Genome Biol. 2017 Nov 20;18(1):219. doi: 10.1186/s13059-017-1345-5. 10.1186/s13059-017-1345-5 PubMed 29151363