Skip to main content
Addgene

pGL4.23-SCP1-ccdB
(Plasmid #131628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131628 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL4.23
  • Backbone manufacturer
    Promega
  • Backbone size (bp) 5813
  • Modifications to backbone
    Minimal promoter was replaced with a synthesized Super core promoter 1 (SCP1). The CmR-ccdB suicide gene was PCR amplified from the STARR-seq vector (kindly provided by Dr. Alexander Stark) using primers containing the SphI-HF and the NdeI recognition site. It was then assembled with the linearized pGL4.23-SCP1 vector (digested by FseI) using Gibson assembly
  • Vector type
    Mammalian Expression, Bacterial Expression, Luciferase
  • Promoter SCP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGCTGGAACACGGTAAA
  • 3′ sequencing primer CGACGGATCCTTATCGATTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23-SCP1-ccdB was a gift from Kevin White (Addgene plasmid # 131628 ; http://n2t.net/addgene:131628 ; RRID:Addgene_131628)
  • For your References section:

    Functional assessment of human enhancer activities using whole-genome STARR-sequencing. Liu Y, Yu S, Dhiman VK, Brunetti T, Eckart H, White KP. Genome Biol. 2017 Nov 20;18(1):219. doi: 10.1186/s13059-017-1345-5. 10.1186/s13059-017-1345-5 PubMed 29151363