pCDEF3-muSOX
(Plasmid
#131695)
-
Purposeexpresses muSOX in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDEF3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemuSOX
-
Alt namemORF37
-
SpeciesMHV68
-
Insert Size (bp)1461
-
GenBank ID
-
Entrez GeneGAMMAHV.ORF37
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer gcgatgcaatttcctcattt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGlaunsinger Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/585984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDEF3-muSOX was a gift from Britt Glaunsinger (Addgene plasmid # 131695 ; http://n2t.net/addgene:131695 ; RRID:Addgene_131695) -
For your References section:
Xrn1 activity broadly represses RNA polymerase II occupancy at mammalian but not viral promoters during herpesvirus infection. Hartenian EN, Glaunsinger BA. bioRxiv 585984 10.1101/585984