pPROEX Hsp104 (361-548)
(Plasmid
#1317)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 1317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPROEX-HTb
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4746
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHsp104 (361-548)
-
Alt nameHsp104
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)583
-
Mutationaa361-548 of Hsp104
-
Entrez GeneHSP104 (a.k.a. YLL026W)
-
Tag
/ Fusion Protein
- 6X His + TEV cleavage (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TACGATATCCCAACGACCGAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPROEX Hsp104 (361-548) was a gift from Susan Lindquist (Addgene plasmid # 1317 ; http://n2t.net/addgene:1317 ; RRID:Addgene_1317) -
For your References section:
Defining a pathway of communication from the C-terminal peptide binding domain to the N-terminal ATPase domain in a AAA protein. Cashikar AG, Schirmer EC, Hattendorf DA, Glover JR, Ramakrishnan MS, Ware DM, Lindquist SL. Mol Cell 2002 Apr;9(4):751-60. 10.1016/S1097-2765(02)00499-9 PubMed 11983167