JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
(Plasmid
#131755)
-
PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR221 P3-P2
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2555
- Total vector size (bp) 3266
-
Vector typeSynthetic Biology ; pMAGIC Gateway Entry plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE#1 SaCas9 gRNA
-
gRNA/shRNA sequenceATCAGTGATAGAGAACGTATG
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer M13F (-20)
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SaCas9 gRNA TRE#1 targets the pTight promoter (Clontech) 6x and has no known targets in the h/m/r genome.
Cloned by ligating annealed SaCas9 TRE#1 oligonucleotides into JI501 (Addgene 121841)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA was a gift from Christopher Newgard (Addgene plasmid # 131755 ; http://n2t.net/addgene:131755 ; RRID:Addgene_131755) -
For your References section:
Creation of versatile cloning platforms for transgene expression and dCas9-based epigenome editing. Haldeman JM, Conway AE, Arlotto ME, Slentz DH, Muoio DM, Becker TC, Newgard CB. Nucleic Acids Res. 2018 Dec 27. pii: 5264291. doi: 10.1093/nar/gky1286. 10.1093/nar/gky1286 PubMed 30590691