pTol2-CreLite
(Plasmid
#131783)
-
PurposeTol2 destination vector carrying Ubi:CreLite with mTagBFP2 as a visual marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepzTol2
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 10559
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology ; Zebrafish Tol2 transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhyBCreC, PIF6CreN, and mTagBFP2
-
Alt nameCreLite
-
SpeciesA. thaliana (mustard weed), Synthetic; Bacteriophage P1, Entacmaea quadricolor
-
Insert Size (bp)3505
-
GenBank ID816394 825382
- Promoter Ubi
-
Tag
/ Fusion Protein
- mTagBFP2
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer attB1: GTTTGTACAAAAAAGCAGGC
- 3′ sequencing primer attB2: CCACTTTGTACAAGAAAGCTGGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: doi.org/10.1101/823971.
This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131783 ; http://n2t.net/addgene:131783 ; RRID:Addgene_131783) -
For your References section:
CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301