Skip to main content
Addgene

pTol2-CreLite
(Plasmid #131783)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131783 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pzTol2
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 10559
  • Vector type
    Mammalian Expression, Cre/Lox, Synthetic Biology ; Zebrafish Tol2 transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhyBCreC, PIF6CreN, and mTagBFP2
  • Alt name
    CreLite
  • Species
    A. thaliana (mustard weed), Synthetic; Bacteriophage P1, Entacmaea quadricolor
  • Insert Size (bp)
    3505
  • GenBank ID
    816394 825382
  • Promoter Ubi
  • Tag / Fusion Protein
    • mTagBFP2

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer attB1: GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer attB2: CCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131783 ; http://n2t.net/addgene:131783 ; RRID:Addgene_131783)
  • For your References section:

    CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301