VAMP8-SuperNova
(Plasmid
#131855)
-
PurposeExpresses SuperNova fused to endosomal SNARE VAMP8
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerCloneTech
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperNova
-
SpeciesSynthetic
- Promoter CMV
-
Tags
/ Fusion Proteins
- VAMP8 (mouse sequence) (N terminal on insert)
- Myc-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The construct for cytosolic expression of SuperNova was constructed by replacing EGFP in pEGFP-N1 with synthetic SuperNova fused to a C-terminal Myc-tag using restriction sites BamHI and NotI. Endosomal targeting was achieved by inserting VAMP8 into the cytosolic SuperNova vector using restriction sites HindIII and BamHI, tagging the C-terminus of VAMP8 with SuperNova which results in luminal localization of SuperNova.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP8-SuperNova was a gift from Geert van den Bogaart (Addgene plasmid # 131855 ; http://n2t.net/addgene:131855 ; RRID:Addgene_131855) -
For your References section:
Radical Stress Is More Cytotoxic in the Nucleus than in Other Organelles. Paardekooper LM, van Vroonhoven E, Ter Beest M, van den Bogaart G. Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147. 10.3390/ijms20174147 PubMed 31450682