Skip to main content
Addgene

FUGW-H2B-mCherry
(Plasmid #132333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW (Addgene #14883)
  • Backbone size w/o insert (bp) 9197
  • Total vector size (bp) 10286
  • Modifications to backbone
    eGFP was released from FUGW via XbaI digest and replaced with H2B-mCherry.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-mCherry
  • Insert Size (bp)
    1089
  • Promoter hUbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hUBCpro-F (CCCCGTAATGCAGAAGAAGA)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    H2B-mCherry was a gift from David Morgan, UCSF.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUGW-H2B-mCherry was a gift from Bjoern Schwer (Addgene plasmid # 132333 ; http://n2t.net/addgene:132333 ; RRID:Addgene_132333)