FUGW-H2B-mCherry
(Plasmid
#132333)
-
PurposeThird generation lentiviral vector for hUbC-driven H2B-mCherry expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW (Addgene #14883)
- Backbone size w/o insert (bp) 9197
- Total vector size (bp) 10286
-
Modifications to backboneeGFP was released from FUGW via XbaI digest and replaced with H2B-mCherry.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-mCherry
-
Insert Size (bp)1089
- Promoter hUbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer hUBCpro-F (CCCCGTAATGCAGAAGAAGA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byH2B-mCherry was a gift from David Morgan, UCSF.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUGW-H2B-mCherry was a gift from Bjoern Schwer (Addgene plasmid # 132333 ; http://n2t.net/addgene:132333 ; RRID:Addgene_132333)