pZmUBQ:GW
(Plasmid
#132358)
-
Purpose(Empty Backbone) Expression of CDS from the Zea mays ubiquitin promotor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepZmUBQ:GW
- Backbone size (bp) 8963
-
Vector typePlant Expression
- Promoter pZmUBQ
-
Selectable markersBasta
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCCTGTTGTTTGGTGTTACTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZmUBQ:GW was a gift from Paul Schulze-Lefert (Addgene plasmid # 132358 ; http://n2t.net/addgene:132358 ; RRID:Addgene_132358) -
For your References section:
A cell death assay in barley and wheat protoplasts for identification and validation of matching pathogen AVR effector and plant NLR immune receptors. Saur IML, Bauer S, Lu X, Schulze-Lefert P. Plant Methods. 2019 Oct 24;15:118. doi: 10.1186/s13007-019-0502-0. eCollection 2019. 10.1186/s13007-019-0502-0 PubMed 31666804