AAVS1 intron 1 gRNA s3
(Plasmid
#132395)
-
PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerAddgene
- Total vector size (bp) 2280
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting AAVS1 intron 1
-
Alt nameAAVS1
-
Alt namePPP1R12C
-
SpeciesH. sapiens (human)
-
Entrez GenePPP1R12C (a.k.a. AAVS1, LENG3, MBS85, p84, p85)
- Promoter hU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGGACTATCATATGCTTACCGTAACTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1 intron 1 gRNA s3 was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 132395 ; http://n2t.net/addgene:132395 ; RRID:Addgene_132395) -
For your References section:
Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies. Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G. Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5. 10.21769/BioProtoc.3615 PubMed 33659578