OA-1050K (firefly luciferase)
(Plasmid
#132422)
-
Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonewhite+attB
- Backbone size w/o insert (bp) 7860
- Total vector size (bp) 8167
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefirefly Luciferase gRNA array
-
gRNA/shRNA sequenceCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACGTGTACATCGACTGAAATCCCTGGTAATCCCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACCAGAGCGACACCTTTAGGCAGACCAGTAGACAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACGGCAACCGCTTCCCCGACTTCCTTAGAGAGCAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAACCGTCGAAGATGTTGGGGTGTTGGAGCAAGACAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC
-
SpeciesD. melanogaster (fly)
- Promoter U6-3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA-1050K (firefly luciferase) was a gift from Omar Akbari (Addgene plasmid # 132422 ; http://n2t.net/addgene:132422 ; RRID:Addgene_132422) -
For your References section:
Programmable RNA Targeting Using CasRx in Flies. Buchman AB, Brogan DJ, Sun R, Yang T, Hsu PD, Akbari OS. CRISPR J. 2020 Jun;3(3):164-176. doi: 10.1089/crispr.2020.0018. 10.1089/crispr.2020.0018 PubMed 32584145