CIRTS-8: bdefensin 3-TBP6.7-hADAR(299-701)E488Q
(Plasmid
#132545)
-
PurposeExpresses CIRTS-8 (bdefensin 3-TBP6.7-hADAR(299-701)E488Q) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecmv d0
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCIRTS-8: bdefensin 3-TBP6.7-hADAR(299-701)E488Q-NLS
-
SpeciesSynthetic
- Promoter cmv d0
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTTAAATTGCTAACGCAGTCA
- 3′ sequencing primer CAGCAGCCAACTCAGCTTCCTTTCGGGCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CIRTS-8: bdefensin 3-TBP6.7-hADAR(299-701)E488Q was a gift from Bryan Dickinson (Addgene plasmid # 132545 ; http://n2t.net/addgene:132545 ; RRID:Addgene_132545) -
For your References section:
Programmable RNA-Guided RNA Effector Proteins Built from Human Parts. Rauch S, He E, Srienc M, Zhou H, Zhang Z, Dickinson BC. Cell. 2019 Jun 27;178(1):122-134.e12. doi: 10.1016/j.cell.2019.05.049. Epub 2019 Jun 20. 10.1016/j.cell.2019.05.049 PubMed 31230714