pCW57-GFP-miR-302cluster
              
              
                (Plasmid
                
                #132549)
              
            
            
            
          - 
            PurposeDoxycycline-inducible expression of human miR-302 cluster
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCW57-GFP-2A-MCS
- 
              Backbone manufacturerBroad Insitute
- Backbone size w/o insert (bp) 8405
- Total vector size (bp) 9043
- 
              Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible, microRNA expression
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namehuman miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)722
- 
                    GenBank ID442894, 442895, 407028, 442896, 442912
- 
    
        Tag
        / Fusion Protein
    - GFP
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GAGGATCACAGCAACACCGA
- 3′ sequencing primer CCTTGGAAAAGGCGCAACC (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCW57-GFP-miR-302cluster was a gift from Tomáš Bárta (Addgene plasmid # 132549 ; http://n2t.net/addgene:132549 ; RRID:Addgene_132549)
- 
                For your References section: Oct4-mediated reprogramming induces embryonic-like microRNA expression signatures in human fibroblasts. Peskova L, Cerna K, Oppelt J, Mraz M, Barta T. Sci Rep. 2019 Oct 31;9(1):15759. doi: 10.1038/s41598-019-52294-3. 10.1038/s41598-019-52294-3 PubMed 31673026
 
    
 
                         
             
            