GS2.1/EC
(Plasmid
#132568)
-
PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepH2GW7
-
Backbone manufacturerhttps://gateway.psb.ugent.be
- Backbone size w/o insert (bp) 8820
- Total vector size (bp) 16355
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameegg cell promoter, Cas9-mApple, pds3 sgRNA
-
Alt nameCas9-mApple fusion protein
-
Alt namesgRNA targeting A. thaliana pds3
-
Alt nameArabidopsis egg cell promoter
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)7396
- Promoter A. thaliana egg cell promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atcggtgcgggcctcttcgctattacgccaGAATAAAAGCATTTGCGTTTGGT
- 3′ sequencing primer TCTTCAAAAGTACCACAGCGCTTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe PDS3 gRNA was amplified from pUC119-gRNA, a gift from Jen Sheen (Addgene plasmid # 52255 ; http://n2t.net/addgene:52255 ; RRID:Addgene_52255). Cas9 was amplified from pFGC-pcoCas9, a gift from Jen Sheen (Addgene plasmid # 52256 ; http://n2t.net/addgene:52256 ; RRID:Addgene_52256).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GS2.1/EC was a gift from Mathias Pribil (Addgene plasmid # 132568 ; http://n2t.net/addgene:132568 ; RRID:Addgene_132568) -
For your References section:
Antimicrobial solid media for screening non-sterile Arabidopsis thaliana seeds. Behrendorff JBYH, Borras-Gas G, Pribil M. Physiol Plant. 2020 Feb 25. doi: 10.1111/ppl.13079. 10.1111/ppl.13079 PubMed 32096870