fIM1265
(Plasmid
#132577)
-
PurposepZA2-pLlacO-soxR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZA2
- Backbone size w/o insert (bp) 1953
- Total vector size (bp) 2665
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepLlacO-soxR-TermT1
-
Insert Size (bp)712
-
Entrez GenesoxR (a.k.a. b4063, ECK4055, marC)
- Promoter pLlacO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAAGAAAGCCATCCAGTTT
- 3′ sequencing primer TGGCATCTTCCAGGAAATCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fIM1265 was a gift from Timothy Lu (Addgene plasmid # 132577 ; http://n2t.net/addgene:132577 ; RRID:Addgene_132577) -
For your References section:
Gene networks that compensate for crosstalk with crosstalk. Muller IE, Rubens JR, Jun T, Graham D, Xavier R, Lu TK. Nat Commun. 2019 Sep 6;10(1):4028. doi: 10.1038/s41467-019-12021-y. 10.1038/s41467-019-12021-y PubMed 31492904