Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBbAW4k-loxP-TT-loxP-mRFP1
(Plasmid #134405)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134405 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBbA-k
  • Backbone size w/o insert (bp) 2432
  • Total vector size (bp) 3445
  • Vector type
    Bacterial Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MG1655
  • Growth instructions
    When transformed with Opto-Cre-Vvd, store in the dark.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    W4-loxP-TT-loxP-mRFP1
  • Insert Size (bp)
    1013
  • Promoter W4 (modified T7A1)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCTTCCCCATCGGTGATGTCG
  • 3′ sequencing primer TTTCGCCACCACTGATTTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/786533v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbAW4k-loxP-TT-loxP-mRFP1 was a gift from Mary Dunlop (Addgene plasmid # 134405 ; http://n2t.net/addgene:134405 ; RRID:Addgene_134405)
  • For your References section:

    Light-Inducible Recombinases for Bacterial Optogenetics. Sheets MB, Wong WW, Dunlop MJ. ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21. 10.1021/acssynbio.9b00395 PubMed 31961670