Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #134404)


Item Catalog # Description Quantity Price (USD)
Plasmid 134404 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3709
  • Total vector size (bp) 5720
  • Vector type
    Bacterial Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    When transformed with Cre reporter, store in the dark.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaattgtgagcggataacaatttc
  • 3′ sequencing primer cgttttatttgatgcctggagatcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbE5a-Opto-Cre-Vvd was a gift from Mary Dunlop (Addgene plasmid # 134404 ; ; RRID:Addgene_134404)
  • For your References section:

    Light-Inducible Recombinases for Bacterial Optogenetics. Sheets MB, Wong WW, Dunlop MJ. ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21. 10.1021/acssynbio.9b00395 PubMed 31961670