-
PurposeExpresses ErCas12a and an sgRNA to target a region of interest
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA
-
Backbone manufacturerDr. Feng Zhang
- Backbone size w/o insert (bp) 4206
- Total vector size (bp) 8046
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameErCas12a
-
Alt nameMad7
-
SpeciesEubacterium rectale
-
Insert Size (bp)3840
-
MutationQ926R (Please see depositor comments) and BsaI site removed via SDM on ErCas12a gene sequence with a silent mutation
-
GenBank IDMH347339.1
- Promoter CMV Promoter
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
- 3x HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHi (not destroyed)
- 5′ sequencing primer GCTCTCTGGCTAACTACCGGT
- 3′ sequencing primer GGTACCTCCCCAGCATGCCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe codon optimized sequence of this gene was ordered as a geneblock from IDT from Jeff Essner's lab, who is co-corresponding author of the manuscript this construct is derived from.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Q926R mutation in ErCas12a does not affect function. This plasmid was used successfully in associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pErCas12a EZ Clone was a gift from Stephen Ekker (Addgene plasmid # 132641 ; http://n2t.net/addgene:132641 ; RRID:Addgene_132641) -
For your References section:
Expanding the CRISPR Toolbox with ErCas12a in Zebrafish and Human Cells. Wierson WA, Simone BW, WareJoncas Z, Mann C, Welker JM, Kar B, Emch MJ, Friedberg I, Gendron WAC, Barry MA, Clark KJ, Dobbs DL, McGrail MA, Ekker SC, Essner JJ. CRISPR J. 2019 Dec;2(6):417-433. doi: 10.1089/crispr.2019.0026. Epub 2019 Nov 19. 10.1089/crispr.2019.0026 PubMed 31742435