Skip to main content

Hy_pPepck1 eGFP SV40
(Plasmid #132644)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132644 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Hy_pMtnA eGFP
  • Total vector size (bp) 8509
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eGFP
  • Promoter Pepck1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTACCTGCCTGGACAGCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pPepck1 eGFP SV40 was a gift from Jeremy Wilusz (Addgene plasmid # 132644 ; http://n2t.net/addgene:132644 ; RRID:Addgene_132644)
  • For your References section:

    The Integrator complex cleaves nascent mRNAs to attenuate transcription. Tatomer DC, Elrod ND, Liang D, Xiao MS, Jiang JZ, Jonathan M, Huang KL, Wagner EJ, Cherry S, Wilusz JE. Genes Dev. 2019 Sep 17. pii: gad.330167.119. doi: 10.1101/gad.330167.119. 10.1101/gad.330167.119 PubMed 31530651