Skip to main content

CMV-ShadowR
(Plasmid #132668)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132668 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3287
  • Total vector size (bp) 3995
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ShadowR
  • Insert Size (bp)
    708
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-ShadowR was a gift from Hideji Murakoshi (Addgene plasmid # 132668 ; http://n2t.net/addgene:132668 ; RRID:Addgene_132668)
  • For your References section:

    ShadowR: a novel chromoprotein with reduced non-specific binding and improved expression in living cells. Murakoshi H, Horiuchi H, Kosugi T, Onda M, Sato A, Koga N, Nabekura J. Sci Rep. 2019 Aug 19;9(1):12072. doi: 10.1038/s41598-019-48604-4. 10.1038/s41598-019-48604-4 PubMed 31427680