CMV-ShadowR
(Plasmid
#132668)
-
PurposeExpresses ShadowR in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3287
- Total vector size (bp) 3995
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShadowR
-
Insert Size (bp)708
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-ShadowR was a gift from Hideji Murakoshi (Addgene plasmid # 132668 ; http://n2t.net/addgene:132668 ; RRID:Addgene_132668) -
For your References section:
ShadowR: a novel chromoprotein with reduced non-specific binding and improved expression in living cells. Murakoshi H, Horiuchi H, Kosugi T, Onda M, Sato A, Koga N, Nabekura J. Sci Rep. 2019 Aug 19;9(1):12072. doi: 10.1038/s41598-019-48604-4. 10.1038/s41598-019-48604-4 PubMed 31427680