Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CMV-ShadowR
(Plasmid #132668)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 132668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3287
  • Total vector size (bp) 3995
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ShadowR
  • Insert Size (bp)
    708
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-ShadowR was a gift from Hideji Murakoshi (Addgene plasmid # 132668 ; http://n2t.net/addgene:132668 ; RRID:Addgene_132668)
  • For your References section:

    ShadowR: a novel chromoprotein with reduced non-specific binding and improved expression in living cells. Murakoshi H, Horiuchi H, Kosugi T, Onda M, Sato A, Koga N, Nabekura J. Sci Rep. 2019 Aug 19;9(1):12072. doi: 10.1038/s41598-019-48604-4. 10.1038/s41598-019-48604-4 PubMed 31427680