Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

stabilized HP35 tension sensor module
(Plasmid #101251)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101251 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLPCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6238
  • Total vector size (bp) 7795
  • Modifications to backbone
    modified multicloning site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    YPet(short)-HP35st-mCherry
  • Alt name
    HP35st tension sensor module
  • Insert Size (bp)
    1509
  • Promoter CMV
  • Tags / Fusion Proteins
    • cysteine (N terminal on insert)
    • cysteine (C terminal on insert)
    • His-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    stabilized HP35 tension sensor module was a gift from Carsten Grashoff (Addgene plasmid # 101251 ; http://n2t.net/addgene:101251 ; RRID:Addgene_101251)
  • For your References section:

    Extracellular rigidity sensing by talin isoform-specific mechanical linkages. Austen K, Ringer P, Mehlich A, Chrostek-Grashoff A, Kluger C, Klingner C, Sabass B, Zent R, Rief M, Grashoff C. Nat Cell Biol. 2015 Dec;17(12):1597-606. doi: 10.1038/ncb3268. Epub 2015 Nov 2. 10.1038/ncb3268 PubMed 26523364