Skip to main content

pENN.AAV.CB7.CI.CNDP1-flag.WPRE.rBG
(Plasmid #132683)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132683 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pENN.AAV.CB7.CI.insert.WPRE.rBG
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7300
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Carnosine dipeptidase 1
  • Alt name
    CNDP1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1500
  • Entrez Gene
    Cndp1 (a.k.a. AI746433, Cn1)
  • Promoter Chicken b-actin
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer WPRE-R, CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENN.AAV.CB7.CI.CNDP1-flag.WPRE.rBG was a gift from Jonathan Long (Addgene plasmid # 132683 ; http://n2t.net/addgene:132683 ; RRID:Addgene_132683)
  • For your References section:

    Family-wide Annotation of Enzymatic Pathways by Parallel In Vivo Metabolomics. Kim JT, Li VL, Terrell SM, Fischer CR, Long JZ. Cell Chem Biol. 2019 Nov 21;26(11):1623-1629.e3. doi: 10.1016/j.chembiol.2019.09.009. Epub 2019 Oct 3. 10.1016/j.chembiol.2019.09.009 PubMed 31587987