pRDV5 containing Sb-convex
(Plasmid
#132696)
-
PurposepRDV5 plasmid containing a convex Sybody for the generation of a qPCR standard curve
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRDVFX5
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSb_convex including 5' and 3' flanking sequences used for ribosome display
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRDV5 containing Sb-convex was a gift from Markus Seeger (Addgene plasmid # 132696 ; http://n2t.net/addgene:132696 ; RRID:Addgene_132696) -
For your References section:
Generation of synthetic nanobodies against delicate proteins. Zimmermann I, Egloff P, Hutter CAJ, Kuhn BT, Brauer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA. Nat Protoc. 2020 Apr 8. pii: 10.1038/s41596-020-0304-x. doi: 10.1038/s41596-020-0304-x. 10.1038/s41596-020-0304-x PubMed 32269381