pCMJJ4-FOXO3-IRES-Thy1.1
(Plasmid
#132703)
-
PurposeExpresses Thy1.1 and FOXO3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMJJ4
- Backbone size w/o insert (bp) 9900
- Total vector size (bp) 11996
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFOXO3
-
Alt nameforkhead box O3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1900
-
GenBank IDNM_001455
-
Entrez GeneFOXO3 (a.k.a. AF6q21, FKHRL1, FKHRL1P2, FOXO2, FOXO3A)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pme1 (destroyed during cloning)
- 3′ cloning site Pme1 (destroyed during cloning)
- 5′ sequencing primer ATAGTCGATTCATGCGGGTCCAGA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFOXO3 gene obtained from Origene (Cat.# RG209846). The pCMJJ4 vector was a gift from Joshy Jacob (Emory University), which contains the Thy1.1 insert. Cloning was performed by Oskar Laur at the Emory Integrated Genomics Core.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMJJ4-FOXO3-IRES-Thy1.1 was a gift from Mandy Ford (Addgene plasmid # 132703 ; http://n2t.net/addgene:132703 ; RRID:Addgene_132703) -
For your References section:
CD28-Dependent CTLA-4 Expression Fine-Tunes the Activation of Human Th17 Cells. Krummey SM, Hartigan CR, Liu D, Ford ML. iScience. 2020 Apr 24;23(4):100912. doi: 10.1016/j.isci.2020.100912. Epub 2020 Feb 14. 10.1016/j.isci.2020.100912 PubMed 32203908