Skip to main content

pCMJJ4-FOXO3-IRES-Thy1.1
(Plasmid #132703)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132703 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMJJ4
  • Backbone size w/o insert (bp) 9900
  • Total vector size (bp) 11996
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FOXO3
  • Alt name
    forkhead box O3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1900
  • GenBank ID
    NM_001455
  • Entrez Gene
    FOXO3 (a.k.a. AF6q21, FKHRL1, FKHRL1P2, FOXO2, FOXO3A)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pme1 (destroyed during cloning)
  • 3′ cloning site Pme1 (destroyed during cloning)
  • 5′ sequencing primer ATAGTCGATTCATGCGGGTCCAGA
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FOXO3 gene obtained from Origene (Cat.# RG209846). The pCMJJ4 vector was a gift from Joshy Jacob (Emory University), which contains the Thy1.1 insert. Cloning was performed by Oskar Laur at the Emory Integrated Genomics Core.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMJJ4-FOXO3-IRES-Thy1.1 was a gift from Mandy Ford (Addgene plasmid # 132703 ; http://n2t.net/addgene:132703 ; RRID:Addgene_132703)
  • For your References section:

    CD28-Dependent CTLA-4 Expression Fine-Tunes the Activation of Human Th17 Cells. Krummey SM, Hartigan CR, Liu D, Ford ML. iScience. 2020 Apr 24;23(4):100912. doi: 10.1016/j.isci.2020.100912. Epub 2020 Feb 14. 10.1016/j.isci.2020.100912 PubMed 32203908