pYZ694
(Plasmid
#132956)
-
PurposecrRNA entry vector of Prrk1-Not1-HHR with dFnCas12a-Clr4 in Schizosaccharomyces pombe
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepombe ars1/ura4
- Backbone size w/o insert (bp) 7341
- Total vector size (bp) 12401
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersSpura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructions30°C recommended for this large plasmid. 37°C may also be fine for bacteria growth.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedFnCas12a
-
Alt namedFnCpf1
-
gRNA/shRNA sequenceN/A
-
SpeciesH. sapiens (human)
- Promoter adh1
-
Tags
/ Fusion Proteins
- nucleoplasmin NLS (C terminal on insert)
- SV40 NLS (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGTGCCCTACAACAACTAAGAAAATGG
- 3′ sequencing primer GGGGATCGCAAATTAAAGCCTTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYZ694 was a gift from Jef Boeke (Addgene plasmid # 132956 ; http://n2t.net/addgene:132956 ; RRID:Addgene_132956) -
For your References section:
CRISPR-Cas12a system in fission yeast for multiplex genomic editing and CRISPR interference. Zhao Y, Boeke JD. Nucleic Acids Res. 2020 Jun 4;48(10):5788-5798. doi: 10.1093/nar/gkaa329. 10.1093/nar/gkaa329 PubMed 32374858