pFA-sbtA
(Plasmid
#133011)
-
PurposepFA carrying a Synechococcus elongatus PCC 7942 sbtA gene (Uniprot: Q6UP27)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFA
- Backbone size w/o insert (bp) 2970
- Total vector size (bp) 4107
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSbtA
-
SpeciesSynechococcus elongatus PCC 7942
-
Insert Size (bp)1116
-
GenBank IDSynpcc7942_1475 Synpcc7942_1475
- Promoter tetR
-
Tag
/ Fusion Protein
- 6xhis (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCTTTCGTCTTCACCTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA-sbtA was a gift from David Savage (Addgene plasmid # 133011 ; http://n2t.net/addgene:133011 ; RRID:Addgene_133011) -
For your References section:
DABs are inorganic carbon pumps found throughout prokaryotic phyla. Desmarais JJ, Flamholz AI, Blikstad C, Dugan EJ, Laughlin TG, Oltrogge LM, Chen AW, Wetmore K, Diamond S, Wang JY, Savage DF. Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8. 10.1038/s41564-019-0520-8 PubMed 31406332